Review



murine zfp36  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    Addgene inc murine zfp36
    Figure 2. <t>ZFP36/TTP</t> expression in response to enzalutamide. (A) Representative images and quantification of TTP IHC staining intensity in DARANA patient tissues comparing treatment-naive and post-enzalutamide samples. ****P < 0.0001 (Fisher’s exact test). Scale bars: 100 μm. (B) ZFP36 expression from RNA-Seq before and after enzalutamide in the NCI and DARANA clinical studies. n = 36–52, ****P < 0.0001 (2-tailed paired-samples t test). (C) Correlation of normalized ZFP36 expression versus volume of post-treatment residual cancer burden (RCB) in pre- and post-enzalutamide samples. n = 36 patients (non-parametric Spearman’s correlation). (D) Representative H3K27 acetylation tracks at the ZFP36 locus from 2 DARANA patients, comparing pre- and post-enzalutamide samples. (E) Quantification of H3K27 acetylation signal at the ZFP36 locus before and after enzalutamide treatment (paired-samples t test).
    Murine Zfp36, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/murine zfp36/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    murine zfp36 - by Bioz Stars, 2026-05
    93/100 stars

    Images

    1) Product Images from "Low tristetraprolin expression activates phenotypic plasticity and primes transition to lethal prostate cancer in mice"

    Article Title: Low tristetraprolin expression activates phenotypic plasticity and primes transition to lethal prostate cancer in mice

    Journal: Journal of Clinical Investigation

    doi: 10.1172/jci175680

    Figure 2. ZFP36/TTP expression in response to enzalutamide. (A) Representative images and quantification of TTP IHC staining intensity in DARANA patient tissues comparing treatment-naive and post-enzalutamide samples. ****P < 0.0001 (Fisher’s exact test). Scale bars: 100 μm. (B) ZFP36 expression from RNA-Seq before and after enzalutamide in the NCI and DARANA clinical studies. n = 36–52, ****P < 0.0001 (2-tailed paired-samples t test). (C) Correlation of normalized ZFP36 expression versus volume of post-treatment residual cancer burden (RCB) in pre- and post-enzalutamide samples. n = 36 patients (non-parametric Spearman’s correlation). (D) Representative H3K27 acetylation tracks at the ZFP36 locus from 2 DARANA patients, comparing pre- and post-enzalutamide samples. (E) Quantification of H3K27 acetylation signal at the ZFP36 locus before and after enzalutamide treatment (paired-samples t test).
    Figure Legend Snippet: Figure 2. ZFP36/TTP expression in response to enzalutamide. (A) Representative images and quantification of TTP IHC staining intensity in DARANA patient tissues comparing treatment-naive and post-enzalutamide samples. ****P < 0.0001 (Fisher’s exact test). Scale bars: 100 μm. (B) ZFP36 expression from RNA-Seq before and after enzalutamide in the NCI and DARANA clinical studies. n = 36–52, ****P < 0.0001 (2-tailed paired-samples t test). (C) Correlation of normalized ZFP36 expression versus volume of post-treatment residual cancer burden (RCB) in pre- and post-enzalutamide samples. n = 36 patients (non-parametric Spearman’s correlation). (D) Representative H3K27 acetylation tracks at the ZFP36 locus from 2 DARANA patients, comparing pre- and post-enzalutamide samples. (E) Quantification of H3K27 acetylation signal at the ZFP36 locus before and after enzalutamide treatment (paired-samples t test).

    Techniques Used: Expressing, Immunohistochemistry, RNA Sequencing

    Figure 3. Zfp36 loss accelerates progression of prostate cancer in Pten-null murine tumors. (A) H&E staining of murine tumors highlighting mor- phological progression of wild-type (WT), Ptenf/f Zfp36+/+ (Pten–/–), Ptenf/f Zfp36f/+ (Pten–/– Zfp36+/–), and Ptenf/f Zfp36f/+ (Pten–/– Zfp36–/–) dorsolat- eral prostate tissue at 8, 18, and 38 weeks. Scale bars: 100 μm. (B) Comparative weight of dorsolateral and ventral prostate tissue in GEMMs at 18 and 38 weeks. n = 5 mice per genotype, **P < 0.005, ***P < 0.0005, ****P < 0.0001 (1-way ANOVA with Tukey’s post hoc). (C) Kaplan-Meier graphs from GEMM aging studies show that prostate-specific deletion of Zfp36 significantly reduces time to ethical endpoint in PCa driven by loss of Pten n = 10 mice per genotype (Mantel-Cox log-rank test).
    Figure Legend Snippet: Figure 3. Zfp36 loss accelerates progression of prostate cancer in Pten-null murine tumors. (A) H&E staining of murine tumors highlighting mor- phological progression of wild-type (WT), Ptenf/f Zfp36+/+ (Pten–/–), Ptenf/f Zfp36f/+ (Pten–/– Zfp36+/–), and Ptenf/f Zfp36f/+ (Pten–/– Zfp36–/–) dorsolat- eral prostate tissue at 8, 18, and 38 weeks. Scale bars: 100 μm. (B) Comparative weight of dorsolateral and ventral prostate tissue in GEMMs at 18 and 38 weeks. n = 5 mice per genotype, **P < 0.005, ***P < 0.0005, ****P < 0.0001 (1-way ANOVA with Tukey’s post hoc). (C) Kaplan-Meier graphs from GEMM aging studies show that prostate-specific deletion of Zfp36 significantly reduces time to ethical endpoint in PCa driven by loss of Pten n = 10 mice per genotype (Mantel-Cox log-rank test).

    Techniques Used: Staining

    Figure 4. Zfp36 loss increases an inflammatory prostate cancer phenotype in Pten-null murine tumors. (A) GSEA from RNA-Seq of endpoint GEMM PCa tumors comparing Pten–/– and Pten–/– Zfp36–/– GEMMs, highlighting positively and negatively enriched Hallmark pathways. (B) Phospho-p65 IF and Mas- son’s trichrome staining PCa in Pten–/–, Pten–/– Zfp36+/–, and Pten–/– Zfp36–/– GEMM dorsolateral prostate tissue at 38 weeks, with corresponding quantifi- cation. Scale bars: 100 μm. n = 5 mice per genotype; each mouse has been assigned a unique symbol for comparison across IHC analyses; *P < 0.05, **P < 0.005, ***P < 0.0005, ****P < 0.0001 (1-way ANOVA with Tukey’s post hoc).
    Figure Legend Snippet: Figure 4. Zfp36 loss increases an inflammatory prostate cancer phenotype in Pten-null murine tumors. (A) GSEA from RNA-Seq of endpoint GEMM PCa tumors comparing Pten–/– and Pten–/– Zfp36–/– GEMMs, highlighting positively and negatively enriched Hallmark pathways. (B) Phospho-p65 IF and Mas- son’s trichrome staining PCa in Pten–/–, Pten–/– Zfp36+/–, and Pten–/– Zfp36–/– GEMM dorsolateral prostate tissue at 38 weeks, with corresponding quantifi- cation. Scale bars: 100 μm. n = 5 mice per genotype; each mouse has been assigned a unique symbol for comparison across IHC analyses; *P < 0.05, **P < 0.005, ***P < 0.0005, ****P < 0.0001 (1-way ANOVA with Tukey’s post hoc).

    Techniques Used: RNA Sequencing, Staining, Comparison

    Figure 6. Loss of Zfp36 induces phenotypic plasticity in Pten-null murine prostate tumors. (A) AR, synaptophysin (Syp), and CD45 IF staining PCa in Pten–/–, Pten–/– Zfp36+/–, and Pten–/– Zfp36–/– GEMM dorsolateral prostate tissue at 38 weeks, with corresponding quantification. Scale bars: 100 μm. n = 5 mice per genotype, *P < 0.05 (1-way ANOVA with Tukey’s post hoc). (B) Dual Krt8 and CD45 IF staining in Pten–/– and Pten–/– Zfp36–/– GEMM dorsolateral prostate tissue at 38 weeks. Scale bars: 50 μm.
    Figure Legend Snippet: Figure 6. Loss of Zfp36 induces phenotypic plasticity in Pten-null murine prostate tumors. (A) AR, synaptophysin (Syp), and CD45 IF staining PCa in Pten–/–, Pten–/– Zfp36+/–, and Pten–/– Zfp36–/– GEMM dorsolateral prostate tissue at 38 weeks, with corresponding quantification. Scale bars: 100 μm. n = 5 mice per genotype, *P < 0.05 (1-way ANOVA with Tukey’s post hoc). (B) Dual Krt8 and CD45 IF staining in Pten–/– and Pten–/– Zfp36–/– GEMM dorsolateral prostate tissue at 38 weeks. Scale bars: 50 μm.

    Techniques Used: Staining



    Similar Products

    murine zfp36  (Addgene inc)
    93
    Addgene inc murine zfp36
    Figure 2. <t>ZFP36/TTP</t> expression in response to enzalutamide. (A) Representative images and quantification of TTP IHC staining intensity in DARANA patient tissues comparing treatment-naive and post-enzalutamide samples. ****P < 0.0001 (Fisher’s exact test). Scale bars: 100 μm. (B) ZFP36 expression from RNA-Seq before and after enzalutamide in the NCI and DARANA clinical studies. n = 36–52, ****P < 0.0001 (2-tailed paired-samples t test). (C) Correlation of normalized ZFP36 expression versus volume of post-treatment residual cancer burden (RCB) in pre- and post-enzalutamide samples. n = 36 patients (non-parametric Spearman’s correlation). (D) Representative H3K27 acetylation tracks at the ZFP36 locus from 2 DARANA patients, comparing pre- and post-enzalutamide samples. (E) Quantification of H3K27 acetylation signal at the ZFP36 locus before and after enzalutamide treatment (paired-samples t test).
    Murine Zfp36, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/murine zfp36/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    murine zfp36 - by Bioz Stars, 2026-05
    93/100 stars
    		  Buy from Supplier

    Image Search Results


    Figure 2. ZFP36/TTP expression in response to enzalutamide. (A) Representative images and quantification of TTP IHC staining intensity in DARANA patient tissues comparing treatment-naive and post-enzalutamide samples. ****P < 0.0001 (Fisher’s exact test). Scale bars: 100 μm. (B) ZFP36 expression from RNA-Seq before and after enzalutamide in the NCI and DARANA clinical studies. n = 36–52, ****P < 0.0001 (2-tailed paired-samples t test). (C) Correlation of normalized ZFP36 expression versus volume of post-treatment residual cancer burden (RCB) in pre- and post-enzalutamide samples. n = 36 patients (non-parametric Spearman’s correlation). (D) Representative H3K27 acetylation tracks at the ZFP36 locus from 2 DARANA patients, comparing pre- and post-enzalutamide samples. (E) Quantification of H3K27 acetylation signal at the ZFP36 locus before and after enzalutamide treatment (paired-samples t test).

    Journal: Journal of Clinical Investigation

    Article Title: Low tristetraprolin expression activates phenotypic plasticity and primes transition to lethal prostate cancer in mice

    doi: 10.1172/jci175680

    Figure Lengend Snippet: Figure 2. ZFP36/TTP expression in response to enzalutamide. (A) Representative images and quantification of TTP IHC staining intensity in DARANA patient tissues comparing treatment-naive and post-enzalutamide samples. ****P < 0.0001 (Fisher’s exact test). Scale bars: 100 μm. (B) ZFP36 expression from RNA-Seq before and after enzalutamide in the NCI and DARANA clinical studies. n = 36–52, ****P < 0.0001 (2-tailed paired-samples t test). (C) Correlation of normalized ZFP36 expression versus volume of post-treatment residual cancer burden (RCB) in pre- and post-enzalutamide samples. n = 36 patients (non-parametric Spearman’s correlation). (D) Representative H3K27 acetylation tracks at the ZFP36 locus from 2 DARANA patients, comparing pre- and post-enzalutamide samples. (E) Quantification of H3K27 acetylation signal at the ZFP36 locus before and after enzalutamide treatment (paired-samples t test).

    Article Snippet: (targeting murine Zfp36) and GAGCTCGGTCTTGTATCGAG (targeting human ZFP36), were cloned into the lenti-CRISPR/Cas9v2 vector (Addgene, 52961) according to the protocol of the Zhang laboratory (80).

    Techniques: Expressing, Immunohistochemistry, RNA Sequencing

    Figure 3. Zfp36 loss accelerates progression of prostate cancer in Pten-null murine tumors. (A) H&E staining of murine tumors highlighting mor- phological progression of wild-type (WT), Ptenf/f Zfp36+/+ (Pten–/–), Ptenf/f Zfp36f/+ (Pten–/– Zfp36+/–), and Ptenf/f Zfp36f/+ (Pten–/– Zfp36–/–) dorsolat- eral prostate tissue at 8, 18, and 38 weeks. Scale bars: 100 μm. (B) Comparative weight of dorsolateral and ventral prostate tissue in GEMMs at 18 and 38 weeks. n = 5 mice per genotype, **P < 0.005, ***P < 0.0005, ****P < 0.0001 (1-way ANOVA with Tukey’s post hoc). (C) Kaplan-Meier graphs from GEMM aging studies show that prostate-specific deletion of Zfp36 significantly reduces time to ethical endpoint in PCa driven by loss of Pten n = 10 mice per genotype (Mantel-Cox log-rank test).

    Journal: Journal of Clinical Investigation

    Article Title: Low tristetraprolin expression activates phenotypic plasticity and primes transition to lethal prostate cancer in mice

    doi: 10.1172/jci175680

    Figure Lengend Snippet: Figure 3. Zfp36 loss accelerates progression of prostate cancer in Pten-null murine tumors. (A) H&E staining of murine tumors highlighting mor- phological progression of wild-type (WT), Ptenf/f Zfp36+/+ (Pten–/–), Ptenf/f Zfp36f/+ (Pten–/– Zfp36+/–), and Ptenf/f Zfp36f/+ (Pten–/– Zfp36–/–) dorsolat- eral prostate tissue at 8, 18, and 38 weeks. Scale bars: 100 μm. (B) Comparative weight of dorsolateral and ventral prostate tissue in GEMMs at 18 and 38 weeks. n = 5 mice per genotype, **P < 0.005, ***P < 0.0005, ****P < 0.0001 (1-way ANOVA with Tukey’s post hoc). (C) Kaplan-Meier graphs from GEMM aging studies show that prostate-specific deletion of Zfp36 significantly reduces time to ethical endpoint in PCa driven by loss of Pten n = 10 mice per genotype (Mantel-Cox log-rank test).

    Article Snippet: (targeting murine Zfp36) and GAGCTCGGTCTTGTATCGAG (targeting human ZFP36), were cloned into the lenti-CRISPR/Cas9v2 vector (Addgene, 52961) according to the protocol of the Zhang laboratory (80).

    Techniques: Staining

    Figure 4. Zfp36 loss increases an inflammatory prostate cancer phenotype in Pten-null murine tumors. (A) GSEA from RNA-Seq of endpoint GEMM PCa tumors comparing Pten–/– and Pten–/– Zfp36–/– GEMMs, highlighting positively and negatively enriched Hallmark pathways. (B) Phospho-p65 IF and Mas- son’s trichrome staining PCa in Pten–/–, Pten–/– Zfp36+/–, and Pten–/– Zfp36–/– GEMM dorsolateral prostate tissue at 38 weeks, with corresponding quantifi- cation. Scale bars: 100 μm. n = 5 mice per genotype; each mouse has been assigned a unique symbol for comparison across IHC analyses; *P < 0.05, **P < 0.005, ***P < 0.0005, ****P < 0.0001 (1-way ANOVA with Tukey’s post hoc).

    Journal: Journal of Clinical Investigation

    Article Title: Low tristetraprolin expression activates phenotypic plasticity and primes transition to lethal prostate cancer in mice

    doi: 10.1172/jci175680

    Figure Lengend Snippet: Figure 4. Zfp36 loss increases an inflammatory prostate cancer phenotype in Pten-null murine tumors. (A) GSEA from RNA-Seq of endpoint GEMM PCa tumors comparing Pten–/– and Pten–/– Zfp36–/– GEMMs, highlighting positively and negatively enriched Hallmark pathways. (B) Phospho-p65 IF and Mas- son’s trichrome staining PCa in Pten–/–, Pten–/– Zfp36+/–, and Pten–/– Zfp36–/– GEMM dorsolateral prostate tissue at 38 weeks, with corresponding quantifi- cation. Scale bars: 100 μm. n = 5 mice per genotype; each mouse has been assigned a unique symbol for comparison across IHC analyses; *P < 0.05, **P < 0.005, ***P < 0.0005, ****P < 0.0001 (1-way ANOVA with Tukey’s post hoc).

    Article Snippet: (targeting murine Zfp36) and GAGCTCGGTCTTGTATCGAG (targeting human ZFP36), were cloned into the lenti-CRISPR/Cas9v2 vector (Addgene, 52961) according to the protocol of the Zhang laboratory (80).

    Techniques: RNA Sequencing, Staining, Comparison

    Figure 6. Loss of Zfp36 induces phenotypic plasticity in Pten-null murine prostate tumors. (A) AR, synaptophysin (Syp), and CD45 IF staining PCa in Pten–/–, Pten–/– Zfp36+/–, and Pten–/– Zfp36–/– GEMM dorsolateral prostate tissue at 38 weeks, with corresponding quantification. Scale bars: 100 μm. n = 5 mice per genotype, *P < 0.05 (1-way ANOVA with Tukey’s post hoc). (B) Dual Krt8 and CD45 IF staining in Pten–/– and Pten–/– Zfp36–/– GEMM dorsolateral prostate tissue at 38 weeks. Scale bars: 50 μm.

    Journal: Journal of Clinical Investigation

    Article Title: Low tristetraprolin expression activates phenotypic plasticity and primes transition to lethal prostate cancer in mice

    doi: 10.1172/jci175680

    Figure Lengend Snippet: Figure 6. Loss of Zfp36 induces phenotypic plasticity in Pten-null murine prostate tumors. (A) AR, synaptophysin (Syp), and CD45 IF staining PCa in Pten–/–, Pten–/– Zfp36+/–, and Pten–/– Zfp36–/– GEMM dorsolateral prostate tissue at 38 weeks, with corresponding quantification. Scale bars: 100 μm. n = 5 mice per genotype, *P < 0.05 (1-way ANOVA with Tukey’s post hoc). (B) Dual Krt8 and CD45 IF staining in Pten–/– and Pten–/– Zfp36–/– GEMM dorsolateral prostate tissue at 38 weeks. Scale bars: 50 μm.

    Article Snippet: (targeting murine Zfp36) and GAGCTCGGTCTTGTATCGAG (targeting human ZFP36), were cloned into the lenti-CRISPR/Cas9v2 vector (Addgene, 52961) according to the protocol of the Zhang laboratory (80).

    Techniques: Staining